« Back
Home /
Bepirovirsen

Bepirovirsen

Item no.	HY-147217-5mg
Manufacturer	MedChem Express
CASRN	1403787-62-1
Amount	5 mg
Quantity options	100 mg 10 mg 1 ea 1 mg 5 mg
Category	Inhibitors & Compound Libraries Small Molecules
Type	Inhibitor
Specific against	other
Purity	98.44
Formula	C230H309N88O115P19S19
Citations	[1]Yuen MF, et al. Safety, tolerability and antiviral activity of the antisense oligonucleotide bepirovirsen in patients with chronic hepatitis B: a phase 2 randomized controlled trial. Nat Med. 2021 Oct;27(10):1725-1734.<br/>[2]Han K, et, al. Preclinical and Phase 1 Assessment of Antisense Oligonucleotide Bepirovirsen in Hepatitis B Virus-Transgenic Mice and Healthy Human Volunteers: Support for Clinical Dose Selection and Evaluation of Safety, Tolerability, and Pharmacokinetics of Single and Multiple Doses. Clin Pharmacol Drug Dev. 2022 Oct;11(10):1191-1202.
Smiles	[Bepirovirsen]
ECLASS 10.1	32160490
ECLASS 11.0	32160490
UNSPSC	12000000
Alias	ISIS 505358
Available
Product Description	Bepirovirsen is an antisense oligonucleotide targeting all HBV messenger RNAs. Bepirovirsen leads to reductions in HBV-derived RNAs, HBV DNA and viral proteins. Bepirovirsen can be used for the research of chronic HBV infection. Bepirovirsen binding site sequence (GCACTTCGCTTCACCTCTGC)[1].
StorageTemperature	-20°C (Powder, sealed storage, away from moisture)
Shipping	Blue Ice
Manufacturers Applications	COVID-19-anti-virus
MolecularWeight	7344.00
Clinical Information	Phase 3
Manufacturers Research Area	Infection
Solubility	H2O : ≥ 20 mg/mL
Target	HBV
Manufacturers Target	HBV
Manufacturers Pathway	Anti-infection
Manufacturers Product type	Oligonucleotides

Note: The presented information and documents (Manual, Product Datasheet, Safety Datasheet and Certificate of Analysis) correspond to our latest update and should serve for orientational purpose only. We do not guarantee the topicality. We would kindly ask you to make a request for specific requirements, if necessary.

All products are intended for research use only (RUO). Not for human, veterinary or therapeutic use.

Request Data Sheet

Request product datasheet

Request safety datasheet

Simple Order Order Subscription

Amount: 5 mg

available

Request delivery time