NDUFV3

Item no.	CSB-CL015671HU2
Manufacturer	Cusabio
Amount	10 ug plasmid + 200ul Glycerol
Category	Peptides & Proteins Recombinant Proteins
Type	Proteins
Specific against	other
Sequence	atggctgccccgtgtttgctgcggcaaggacgagccggggcgctgaagactatgctccaggaagcccaggtgtttcgaggacttgcttctacggtttctttgtctgcggaatcagggaagagtgaaaagggtcagccacagaattccaagaagcaaagtccaccaaaaaagccagccccagtgcctgctgagccgtttgacaacactacctacaagaacctgcagcatcatgactacagcacgtacaccttctta
Vector	Vector will be determined during the manufacturing process, either pENTR223.1 or pUC
ECLASS 10.1	32160409
ECLASS 11.0	32160409
UNSPSC	12352202
Similar products	NDUFV3
Available
Gene ID	4731
Vector	Vector will be determined during the manufacturing process, either pENTR223.1 or pUC
Sequence	atggctgccccgtgtttgctgcggcaaggacgagc cggggcgctgaagactatgctccaggaagcccagg tgtttcgaggacttgcttctacggtttctttgtct gcggaatcagggaagagtgaaaagggtcagccaca gaattccaagaagcaaagtccaccaaaaaagccag ccccagtgcctgctgagccgtttgacaacactacc tacaagaacctgcagcatcatgactacagcacgta caccttcttagacctcaacctcgaactctcaaaat tcaggatgcctcagccctcctcaggccgggagtca cctcgacactga
Length	327
Accession No.	BC033766

Note: The presented information and documents (Manual, Product Datasheet, Safety Datasheet and Certificate of Analysis) correspond to our latest update and should serve for orientational purpose only. We do not guarantee the topicality. We would kindly ask you to make a request for specific requirements, if necessary.

All products are intended for research use only (RUO). Not for human, veterinary or therapeutic use.

Request Data Sheet

Request product datasheet

Request safety datasheet

Simple Order Order Subscription

Amount: 10 ug plasmid + 200ul Glycerol

available

Request delivery time