Vergleich

MIRacle mmu-miR-6546-3p miRNA Agomir/Antagomir

ArtNr ACG-AM3089-5OD
Hersteller AcceGen
Menge 5 OD
Kategorie
Typ RNA
Applikationen For research use only
Specific against Mouse
ECLASS 5.1 34160901
ECLASS 6.1 32160414
ECLASS 8.0 32160414
ECLASS 9.0 32160414
ECLASS 10.0.1 32160414
ECLASS 10.1 32160414
ECLASS 11.0 32160414
UNSPSC 41105324
Lieferbar
Description
< strong> MicroRNA: mmu-miR-6546-3p< /strong> Accession Number: MIMAT0029793 Mature Sequence: GAGCGAAGCCCAAGCGCCAGA mmu-miR-6546-3p are small non-coding RNAs of 20-22 nucleotides, typically excised from 60-110 nucleotide foldback RNA precursor structures. miRNAs are involved in crucial biological processes, including development, differentiation, apoptosis, and proliferation, through imperfect pairing with target messenger RNAs (mRNAs) of protein-coding genes and the transcriptional or post-transcriptional regulation of their expression. Click here to browse detailed information about mmu-miR-6546-3p in miRBase. & nbsp; < strong> What is MicroRNA Agomir/Antagomir?< /strong> MicroRNA Agomir is a special-labeled and chemically modified double-stranded small RNA that mimics the endogenous miRNA to regulate the biological function of the target gene. MicroRNA Antagomir is an especially chemically modified miRNA antagonist. It strongly competes with mature miRNAs in the body to prevent the complementary pairing of miRNAs and their target genes, thereby inhibiting miRNAs from functioning. & nbsp; < strong> Why choose mmu-miR-6546-3p miRNA Agomir/Antagomir from AcceGen?< /strong> AcceGen has extended experience in MicroRNA Agomir/Antagomir synthesis services that cover all human, mouse, and rat miRNAs in the current miRBase. Compared to standard miRNA mimics and inhibitors, AcceGen miRNA agomir and antagomir are more resistant to degradation, thus having a lasting effect: minimum for 1 week, up to 5-6 weeks. These products can be used in in vitro or in vivo miRNA functional studies.
Shipping Info
Room Temperature
Storage
-20C / -80C

Hinweis: Die dargestellten Informationen und Dokumente (Bedienungsanleitung, Produktdatenblatt, Sicherheitsdatenblatt und Analysezertifikat) entsprechen unserem letzten Update und sollten lediglich der Orientierung dienen. Wir übernehmen keine Garantie für die Aktualität. Für spezifische Anforderungen bitten wir Sie, uns eine Anfrage zu stellen.

Alle Produkte sind nur für Forschungszwecke bestimmt. Nicht für den menschlichen, tierärztlichen oder therapeutischen Gebrauch.

Menge: 5 OD
Lieferbar: In stock
lieferbar

Vergleichen

Auf den Wunschzettel

Angebot anfordern

Lieferzeit anfragen

Technische Frage stellen

Bulk-Anfrage stellen

Fragen zum Produkt?
 
Schließen