« Zurück
Home /
Bepirovirsen

Bepirovirsen

ArtNr	HY-147217-10mg
Hersteller	MedChem Express
CAS-Nr.	1403787-62-1
Menge	10 mg
Quantity options	100 mg 10 mg 1 ea 1 mg 5 mg
Kategorie	Inhibitors & Compound Libraries Small Molecules
Typ	Inhibitor
Specific against	other
Purity	98.44
Formula	C230H309N88O115P19S19
Citations	[1]Yuen MF, et al. Safety, tolerability and antiviral activity of the antisense oligonucleotide bepirovirsen in patients with chronic hepatitis B: a phase 2 randomized controlled trial. Nat Med. 2021 Oct;27(10):1725-1734.<br/>[2]Han K, et, al. Preclinical and Phase 1 Assessment of Antisense Oligonucleotide Bepirovirsen in Hepatitis B Virus-Transgenic Mice and Healthy Human Volunteers: Support for Clinical Dose Selection and Evaluation of Safety, Tolerability, and Pharmacokinetics of Single and Multiple Doses. Clin Pharmacol Drug Dev. 2022 Oct;11(10):1191-1202.
Smiles	[Bepirovirsen]
ECLASS 10.1	32160490
ECLASS 11.0	32160490
UNSPSC	12000000
Alias	ISIS 505358
Lieferbar
Product Description	Bepirovirsen is an antisense oligonucleotide targeting all HBV messenger RNAs. Bepirovirsen leads to reductions in HBV-derived RNAs, HBV DNA and viral proteins. Bepirovirsen can be used for the research of chronic HBV infection. Bepirovirsen binding site sequence (GCACTTCGCTTCACCTCTGC)[1].
StorageTemperature	-20°C (Powder, sealed storage, away from moisture)
Shipping	Blue Ice
Manufacturers Applications	COVID-19-anti-virus
MolecularWeight	7344.00
Clinical Information	Phase 3
Manufacturers Research Area	Infection
Solubility	H2O : ≥ 20 mg/mL
Target	HBV
Manufacturers Target	HBV
Manufacturers Pathway	Anti-infection
Manufacturers Product type	Oligonucleotides

Hinweis: Die dargestellten Informationen und Dokumente (Bedienungsanleitung, Produktdatenblatt, Sicherheitsdatenblatt und Analysezertifikat) entsprechen unserem letzten Update und sollten lediglich der Orientierung dienen. Wir übernehmen keine Garantie für die Aktualität. Für spezifische Anforderungen bitten wir Sie, uns eine Anfrage zu stellen.

Alle Produkte sind nur für Forschungszwecke bestimmt. Nicht für den menschlichen, tierärztlichen oder therapeutischen Gebrauch.

Arbeitsanleitung (Data Sheet) anfordern

Produkdatenblatt anfordern

Sicherheitsdatenblatt anfordern

Einfache Bestellung Periodische Bestellung

Menge: 10 mg

lieferbar

Vergleichen

Auf den Wunschzettel

Weiterempfehlen per Mail

Angebot anfordern

Lieferzeit anfragen